Главная » 2016 » Ноябрь » 22 » Детекция точечной мутации у быков призводителей.
10:27
Детекция точечной мутации у быков призводителей.

ДЕТЕКЦИЯ ТОЧЕЧНОЙ МУТАЦИИ У БЫКОВ-ПРОИЗВОДИТЕЛЕЙ МЕТОДОМ ПОЛИМЕРАЗНОЙ ЦЕПНОЙ РЕАКЦИИ

Усенбеков Е.С.

РГП на ПХВ «Казахский национальный аграрный университет» г. Алматы, Республика Казахстан, 500013

Введение. В настоящее время описаны сотни наследственных заболеваний крупного рогатого скота различных видов и пород. Быстрота и точность диагностики многих из них значительно повысились благодаря достижениям молекулярной биологии, развитию молекулярно-генетических методов регистрации полиморфных локусов ДНК и мутационных изменений, созданию эффективных ДНК-диагностических процедур для исследования человека и различных видов сельскохозяйственных животных. Анализируя мировую литературу по генетике крупного рогатого скота, следует отметить, что в последние годы получено много новых данных по генетическим дефектам у этого вида животных. Так, если сравнивать количество летальных дефектов крупного рогатого скота в списке Визнера и Виллера 1979, и Millar, 2000, то в первом из них их число равно 46, а во втором 403 [1].

Определение носителей мутаций очень важно для племенных хозяйств. Продажи племенных бычков невозможны без тестирования на летальные мутации. Тестирование коров и телок также необходимо для снижения затрат на осеменение и выращивание молодняка. Все наследственные заболевания крупного рогатого скота в той или иной степени связаны с нарушением репродуктивной функции у коров, снижением резистентности организма телят, у носителей мутации генетического дефекта часто регистрируются эмбриональная смертность, повышение индекса осеменения в результате ранней смертности предимплантационных эмбрионов в период беременности. Так, наследственное заболевание крупного рогатого скота, дефицит лейкоцитарной адгезии, BLAD, (bovine leukocyte adhesion deficiency) сопровождается снижением иммунитета у телят, предрасположенностью у молодняка к бактериальным инфекциям. По данным различных авторов данный генетический дефект наносит большой экономический ущерб животноводству [5].

Комплексное уродство позвоночника у крупного рогатого скота, CVM, (complex vertebral malformation) как летальная аутосомальная рецессивная наследственная болезнь впервые была описана в 2001 году американским ученым Agerholm J.S. [2].

DUMPS (Deficiency of uridine monophosphate synthase), является смертельным наследственным аутосомно-рецессивным расстройством крупного рогатого скота, которое сопровождается эмбриональной смертностью в период имплантации в начальной стадии стельности у коров. В клетках млекопитающих, на последней стадии, синтез пиримидиновых нуклеотидов включает конверсию оротата в уридин монофосфат синтетазу (UMP) и этот биохимический процесс катализируется ферментом UMP синтетаза. Фермент UMP-синтетаза является необходимым для синтеза пиримидиновых нуклеотидов, которые входят в состав ДНК и РНК. Рост и развитие гомозиготных рецессивных предимплантационных эмбрионов заканчиваются эмбриональной смертностью, приблизительно на 40 день после зачатия [5].

Citrullinemia - это врожденное нарушение обмена веществ из-за дефицита фермента цикла мочевины, аргининсукцинат синтетазы (L-citrulline: L-aspartate ligase). Эта болезнь была впервые описана у людей, но относительно недавно установлена у молочного скота Австралии. Обычно больные гомозиготные по гену ritrullinemia телята рождаются нормальными, но на второй и третий день они становятся вялыми, отмечаются признаки депрессии и снижается аппетит. Такие животные погибают на 7 день после рождения с клиническими признаками коллапс, слепота и резкое ухудшение состояние больного животного. Анализ последовательности гена ASAS показал, что нуклеотидная замена C на T является причиной точечной мутации у крупного рогатого скота. Известно, что у животных носителей мутации Citrullinemia исчезает сайт рестрикции для эндонуклеазы Ava II и этот полиморфизм используется для ПЦР диагностики [4,5].

В связи с вышеизложенным, целью настоящей работы было проведение мониторинга племенных быков-производителей на носительство генетических мутации BLAD, CVM, DUMPS и Citrullinemia.

Материал и методика исследований. Исследования проводились на 71 племенных быках-производителей АО «Асыл-Тулик» и на 43 быках ТОО «Асыл» в рамках реализации проекта «Мониторинг племенных животных Республики Казахстан на носительство генетических дефектов с помощью молекулярно-генетических методов» в 2012-2013 гг в учебно-научно-диагностической лаборатории Казахско-Японского инновационного центра Казахского национального аграрного университета. Породный состав исследуемой группы быков-производителей АО»Асыл-Тулик» более 14 пород отечественной и зарубежной селекции и ТОО «Асыл» в основном быки местной Алатауской породы и быки мясной породы зарубежной селекции. Анализ документов племенных животных зарубежной селекции показывает, что 38% быков-производителей были протестированы на наличие генетического дефекта методом полимеразной цепной реакции и результаты тестирования были обозначены BL, бык свободен от гена BLAD синдрома и TV, бык свободен гена CVM.

В качестве материала для исследования были использованы замороженные спермы быков-производителей в соломинках АО «Асыл-Тулик» и спермы, замороженные в виде гранул быков ТОО «Асыл». Объем замороженной спермы в пайеттах 0,2 мл и гранул 0,5 мл. Существуют разные способы выделения ДНК из биологических материалов. Самым распространенным и простым в методическом плане методом остается метод выделения ДНК с помощью фенол-хлороформ-изоамилового спирта. Данный способ позволяет выделить из спермы качественную ДНК в большом количестве и с высокой концентрацией. Однако, этот метод представляет определенную опасность для здоровья исследователя и поэтому нами был использован для выделения ДНК из спермы быков-производителей наряду с фенол-хлороформ-изоамиловый спирт методом, метод выделения ДНК с помощью набора «ДНК сорб В».

Выделение ДНК из замороженной спермы быков-производителей по методу Bahnak. Центрифугировали 0,2 мл спермы в течение 5 минут при 4000 g. Осевшие клетки промывали 0,15 М раствором NaCI, 2мМ ЭДТА и центрифугировали в течение 5 минут при 4000 g. Эту процедуру повторяли еще два раза. Затем, после последнего центрифугирования верхний слой отсасывали с помощью пипетки, а к осадку добавляли лизирующий буфер Bahnak в количестве 1 мл, имеющий следующий состав: 6М гуанидинтиоцианат, 25 мМ цитрат натрия рН 7,0, 0,5% Sarcosyl, 0,1 М 2-меркаптоэтанол и инкубировали при 370С в течение 30 минут. Перед депротеинизацией лизированный раствор ДНК разбавляли 0,15 М раствором NaCL в соотношении 1:4. Депротеинизацию осуществляли по обычной методике, путем добавления равного объема смеси фенол-хлороформ-изоамиловый спирт (24:24:1). После центрифугирования осторожно отсасывали верхний слой пипеткой и осаждали в двух объемах 96% этилового спирта. Высушивали ДНК 2-5 минут под вытяжным шкафом и растворяли в буфере ТЕ [3].

Выделение ДНК из замороженной спермы быков-производителей с помощью набора «ДНК сорб В». С целью оптимизации и выделения более качественной ДНК из спермы быков-производителей нами был использован способ предварительной обработки спермы следующим образом: вносим в пробирку 200 мкл спермы, затем добавляем 1 мл лизирующего буфера, имеющий состав 100 мМ Трис, 20 мМ ЭДТА, 10 мМ NaCI, рН 8,0 и перемешиваем в течение 30 секунд и центрифугируем при обороте 10000 об/мин в течение 5 минут. После центрифугирования, суспендируем осадок в 500 мкл буфера: 100 мМ

Трис, 20 мМ ЭДТА, 10 мМ NaCI, рН 8,0 и добавляем 8 мкл 2- меркаптоэтанола. Затем необходимо перемешать на вортексе в течение 1 минуты и оставить на 30 минут в комнатной температуре. Подготовленную таким способом смесь в количестве 100 мкл используем для выделения ДНК с помощью набора «ДНК сорб-В» согласно инструкции.

Проведение полимеразной цепной реакции для детекции точечной мутации у быков-производителей. Тестирование животных на наличие генетических дефектов в первую очередь включает выбор праймеров для амплификации нужного фрагмента ДНК. Нами была проведена работа по подбору соответствующих пар праймеров для проведения эксперимента. Сначала с сайта NCBI вытащили из базы данных полную последовательность генов BLAD, CVM, DUMPS и Citrullinemia. Для ПЦР диагностики BLAD и CVM использовали последовательности праймеров других авторов, а для выявления мутации DUMPS, Citrullinemia кроме праймеров известных авторов, был произведен дизайн собственных праймеров с помощью программы Primer 3. При разработке праймеров мы учитывали размер амплифицируемого фрагмента, для хорошей визуализации при агарозном электрофорезе и размеры фрагментов после рестрикции соответствующей эндонуклеазой, оптимальной длины для определения носителей мутации.

Полимеразную цепную реакцию проводили на термоциклере «Терцик» производства России, который имеет четыре блока по 10 ячеек в каждом блоке. Для выявления полиморфизма гена CD 18 мы использовали следущие праймеры: прямой праймер 5 -AGGCAGTTGCGTTCAATGTGA - 3' и обратный праймер 5-CCGACTCGGTGATGCCATTGA- 3'. Специфические праймеры были синтезированы лабораторией Applied Biosystems. Использование данной пары праймеров позволяет амплифицировать 159 пар нуклеотидов фрагмента гена CD 18.

61

 

Рисунок 1. Электрофореграмма амплификата гена CD 18, длина амплификата 159 п.н.

Условия проведения полимеразной цепной реакции: первый шаг денатурация ДНК при температуре 94 °С - 5 минут, второй шаг денатурация при 94 °С - 45 сек, отжиг праймеров - 62 °С 45 сек и элонгация при температуре 72 °С 45 сек. Завершающий синтез при 72 °С с продолжительностью 2 мин. Хранение при +4 °С. Объем реакционной смеси был 50 мкл, имеющий следующий состав: 5 мкл 10 Х буфера для ПЦР, 1,5 мМ MgCl2, 2,5 мкл 25 мкМ прямого и обратного праймеров, 5 мкл 0,2 мМ концентрации каждого dNTP, 0,5 мкл фермента Taq Polymerase с активностью 5u/pl, 5 мкл ДНК и 26,5 мкл дистиллированной воды. Готовили обычно реакционную смесь на 10 реакции и внесли в каждую пробирку готовую ПЦР реакционную смесь в количестве 18,5 мкл и добавляли в каждый образец по 5 мкл ДНК и нанесли по 2 капли минерального масла. Для проведения полимеразной цепной реакции использовали тонкостенную пробирку Эппедорфа объемом 0,5 мл.


Объявление скрыто.
Продолжительность амплификации составила 35-40 циклов, после окончания амплификации готовили 3% агарозу и заливали гель. В каждую лунку агарозного геля внесли по 7 мкл амплификата, а в первую лунку в качестве ДНК маркера, pUC19DNA рестрицированная рестриктазой MspI. Данный маркер имеет, фрагментов длиной 501,489, 404, 331, 242, 190, 147, 111, 110, 67, 34, 34 пар нуклеотидов. Продукт амплификации подвергали электрофорезу при режиме: напряжение 180 В, сила тока 150 мА, мощность 50 Вт и продолжительность 45-60 минут. В случае успешной амплификации, на электрофореграмме хорошо видно бэнд размером 159 п.н.(рисунок 1). Визаулизацию результатов амплификации и продукта рестрикции осуществляли с помощью гель-документирующей системы. Результаты электрофореза документировали в виде электронного варианта и распечатали электрофреграммы. У здоровых животных появляется сайт рестрикции для рестриктазы Taq I и амплификат после рестрикции дает два фрагмента размером 110 и 49 пар нуклеотидов (рисунок 2).

62

Рисунок 2. Электрофореграмма продуктов рестрикции амплификата гена CD 18 эндонуклеазой Taq I, длина фрагментов 49 и 110 п.н.

Американскими учеными была изучена G/T мутация гена SLC35A3 в позиции 559 при наследственном заболеваний - CVM. На основании этих исследований японскими учеными были подобраны праймеры для выявления мутации CVM у крупного рогатого скота.

Мы использовали метод ПДРФ анализа ПЦР продуктов. Замена G (дикий тип аллели) на T (CVM-аллель) приводит при использовании праймеров F 5'- CACAATTTGTAGG TCTCACTGCA, R 5'-CGATGAAAAAGGAACCAAAAGGG - 3' к исчезновению сайта для рестриктазы PstI. При использовании праймеров F 5'-CACAATTTGTAGGTCTCAATGCA- 3', R 5'-

CGATGAAAAAGGAACCAAAAGGG - 3' появляется сайт рестрикции для EcoT22 выявляющий мутантную аллель.

Также нами для выявления носителей мутации CVM были использованы аллель специфические праймеры CVM - G, F 5'-CACAATTTGTAGGTCTCATGGCAG- 3' и CVM - Т, F 5'-CACAATTTGTAGGTCTCATGGCAT- 3' и R 5'-

CGATGAAAAAGGAACCAAAAGGG - 3'. ПЦР проводили в общем объеме 50 мкл, содержащем 1-2 ед. Taq - полимеразы, по 0,25 тМ каждого dNTP, 67 тМ трис -HCl pH 8,6, 1,5 mM MgCl2, 16,6 mM NHOH, по 0,5 мкм каждого праймера и 100-150 нг ДНК.

Для ПЦР анализа по локусам DUMPS, Citrullinemia кроме существующих праймеров, мы разработали дизайн собственных праймеров. Так, для амплификации участка гена ASAS (Citrilumenia) прямой праймер Usen-1, 5'- AAGGAGTTTGTGGAGGAGTTCAT - 3' и обратный праймер Usen-2, 5' - GAGACACATACTTGGCTCCTTCTC -3. Использование данного набора праймеров позволяет амплифицировать фрагмент гена ASAS длиной 151 п.н. и после рестрикции получаем фрагменты размерами: 58, 93 и 151 п.н. Также для ПДРФ-ПЦР анализа Citrilumenia нами были использованы праймеры, разработанные Grupe S. F 5'-AGGTGTTCATTGAGGACATC ' -3' и R 5' -CGCCGTGAGACACATACTTG-3'. Данная пара праймеров позволяет амплифицировать участок гена Citrilumenia длиной 181 п.н., размеры фрагментов после рестрикции - 82, 99 и 181 п.н. [4].

Немецкие ученые B. Schwenger для детекции точечной мутации DUMPS использвали следующие праймеры: F 5'- GCAAATGGCTGAAGAACATTCTG ' -3' и R 5' - GCTTCTAACTGAACTCCTGGAGT--3', при этом длина амплификата была 108 п.н., после рестрикции были бэнды 52, 56 и 108 п.н. Нами были разработаны праймеры, F 5'- TGAGTTCAATGTGACATGAGAAAAT -3' и R 5' -ATTACCAATCAATAGGCTTACCTCC-3', позволяющие амплифицировать фрагмент гена UMP размером 236 п.н. и после обработки эндонуклеазой 82, 154 и 236 п.н. [6].

ДНК, выделенная из замороженной спермы быков была амплифицирована для ПЦР диагностики DUMPS и Citrullinemia в течение 40-45 циклов. Продукт амплификации проверяли в 3%-ной агарозе. Для выявления носителей мутации DUMPS ставили рестрикцию амплификата с рестриктазой Ava I, а для детекции носителей Citrullinemia рестриктазой Ava II. После рестрикции ставили горизонтальный электрофорез в 3%-ной агарозе и результаты электрофореза зафиксировали с помощью гель-документирующей системы. В таблице 1 показаны основные параметры амплификатов и продуктов рестрикции при генотипировании быков-производителей на - BLAD, CVM, DUMPS и Citrullinemia.

Таблица 1. Основные характеристики амплификатов и продуктов рестрикции при генетических дефектах крупного рогатого скота - BLAD, CVM, DUMPS и Citrullinemia

63

Результаты исследований и их обсуждение. В результате проведенных экспериментов в течение 2012-2013 гг были протестированы всего быков-производителей АО «Асыл-Тулик» 71 голова и ТОО «Асыл» 43 головы на наличие генетических мутации BLAD и CVM, 54 голов быков-производителей АО «Асыл-Тулик» на генетические дефекты DUMPS, Citrullinemia.

Важным этапом настоящей работы была оптимизация условий проведения полимеразной цепной реакции и способов выделения ДНК из спермы. Экпериментальным путем были установлены оптимальный состав ПЦР буфера и необходимая концентрация MgCl2 для ПЦР диагностики BLAD. Успешно амплификация прошла при концентрации 1,5 мМ MgCl2, оптимальным был состав буфера 100 мМ Tris-HCI (рН 8,8), 500 мМ KCI. При повышении концентрации MgCl2 до 3 -4 мМ отмечается неспецифическая амплификация, а при снижении концентрации MgCl2 наблюдается очень низкий сигнал.

При проведении ПДРФ-ПЦР анализа большое значение имеет качество используемой ДНК. Опыт работы показывает, что выход пригодной для амплификации ДНК обеспечивает выделение ДНК по методу Bahnak, где предусмотрено использование фенол-хлороформ-изоамилового спирта. Применение способа выделения ДНК с помощью набора «ДНК сорб В» позволяет генотипировать племенных животных методом ПЦР анализа, однако выход ДНК относительно низкий и составляет 60-70 %.

По результатам исследования 71 быки-производители АО «Асыл-Тулик» и 43 головы ТОО «Асыл» имеют нормальный генотип по исследуемым локусам, BLAD и CVM. Отсутствие носителей генетических дефектов у племенных быков-производителей можно объяснить тем, что основная часть исследуемых животных, быки-производители были местной породы, Алатауской, Аулиекольской, Казахской белоголовой, Аулиеатинской, которые в своей родословной не имеют предков, носителей мутации. Быков-производителей импортной селекции проверены всего 52 головы, из них 27 животные были тестированы на наличие генетических дефектов BLAD и CVM. В настоящее время методом полимеразной реакции были проверены 54 головы на наличие точечной мутации DUMPS, Citrullinemia и результаты отрицательные.

Заключение. Результаты исследований позволяют утверждать, что для мониторинга племенных животных наиболее доступным и точным способом является - метод полимеразной цепной реакции в сочетании с ПДРФ анализом. На основании полученных данных можно сделать заключение, что племенные быки-производители АО «Асыл-Тулик» и ТОО «Асыл» являются свободными от вредных генетических мутации, BLAD, CVM, DUMPS и Citrullinemia.

ЛИТЕРАТУРА

1. Марзанов Н.С., Ескин Г.В., Турбина И.С., Девришев Д.А., Тохов М.Х., Марзанова С.Н. Генодиагностика и распространение аллеля иммунодефицита, или BLAD синдрома, у черно-пестрой породы крупного рогатого скота. Москва 2013.

2. Agerholm JS: Inherited disorders in Danish cattle. APMIS 2007, 122 (Suppl).

3. Bahnak B.R. A single and efficient vethod for isjlating high molecular weight DNA from mammalian sperm.// NAR. -1988. J Veter. Medic. Sci.. 1993 V.55.-p. 145-156

4. Grupe S, Diet G, Schwerin M: Population survey of citrullinemia on German Hol-steins. livestock Prod Sci 1996, 45:35-38.

5. Meydan H, Mehmet Y, Agerholm J Screening for bovine leukocyte adhesion deficiency, deficiency of uridine monophosphate synthase, complex vertebral malformation, bovine citrullinaemia, and factor XI deficiency in Holstein cows reared in Turkey Acta Veterinar-ia Scandinavica 2010, 52:56

6. Schwenger B, Tammen I, Aurich C: Detection of homozygous recessive genotype for deficiency of uridine monophosphate synthase by DNA typing among bovine embryos produced in vitro. J Reprod Fertil 1994, 100:511-514.

 
 
Просмотров: 150 | Добавил: chipka | Теги: быки, днк, мутации | Рейтинг: 0.0/0
Всего комментариев: 0
Добавлять комментарии могут только зарегистрированные пользователи.
[ Регистрация | Вход ]
Приветствую Вас Гость